circad | circRNAs associated with diseases

circRNA-000911
Gene	IFNGR2	Organism	Human
Genome Locus	chr21:34797903:34797990:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29431182
Experimental Method
Sample Type	Tissues	Comparison	cancer tissues and paired adjacent non-cancerous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAAAGCAAGCAGTGCCCATA Reverse GCTCGAATCAGGTCCACCA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Wang, H, Xiao, Y, Wu, L, Ma, D (2018). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-000911/miR-449a pathway in breast carcinogenesis. Int. J. Oncol., 52, 3:743-754.